EST 910280 is a singleton


Sequence

>910280 (1 EST) Length=187 AGGGGGAAAATGTTCCCGGGGGCGACACACTCTAGGGTACTACACAGCTACACCTCTGCGCGTGGAGCAATGGGATCTGT GCACTGCATACGGGTCCGGAGCATTCACAGACACATGTGCGAACGCGAACGTACATACAGCATCACGCGAAGTTCCGGTA CCAACTGTAGCTTCATCTGGATCGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910280: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102801906744AA269277MU1MA087.ALSS. mansoni Schistosomule Lambda Zap


Date: 22:32:47 on Tue 21 Nov 117.