EST 910281 is a singleton


Sequence

>910281 (1 EST) Length=178 GCCGCAGGGGCAGAATATACGCGGGGAGACTCCGCGAGTTCAATAACTTCCCGGACCCTCGTAGCTACTCGAGCAGCGTA TGCATGTAGAGCGTGTGGTTCGTACGCGAGCACTCATGCGAATGTAGCGCGTCGAATGACGACCGCAGACAGTCTGCGCC TAACGCACGAACTCATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910281: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102811906745AA269278MU1MA088.ALSS. mansoni Schistosomule Lambda Zap


Date: 12:48:25 on Sat 18 Nov 117.