EST 910282 is a singleton


Sequence

>910282 (1 EST) Length=172 AACAAGCACCACCCCTCATATAGCTAGCGCTGGTACACTGTGCAGACAGCCTACCTGTGCTCGATGCCTCGTATCGATAG AACTCCACAGGAAGTCAAGTACGAGACAAGGCTAACTGACATGTCTGTCTATACCACGGCCACGCTCACCCGATATGTCG CTATGCAAGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910282: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102821906746AA269279MU1MA089.ALSS. mansoni Schistosomule Lambda Zap


Date: 2:19:14 on Mon 20 Nov 117.