EST 910283 is a singleton


Sequence

>910283 (1 EST) Length=168 GGGCCCCGGGGGCGCCCGGACAATACCTGTGTGGTCTACCGGTATCATCTCTTGCGCGTCGCATTACATCGCGTACCTCT CGCGAGCTTCATGCAGCGTGAGACCGCATGTCTAGGCGCAGCGTACTGCGCGATCACGATGAGCTGTCTCTGATGCTGGC CTAGCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910283: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102831906747AA269280MU1MA090.ALSS. mansoni Schistosomule Lambda Zap


Date: 12:35:25 on Fri 17 Nov 117.