EST 910284 is a singleton


Sequence

>910284 (1 EST) Length=181 GATATCGCACGAGTAGCGCAACTCTCGTGTAGTGCGCCAACACGTTAGTGGCGCTGTCCAAAGCGATGTCCTGCCAGGCT TTAGAACATTCACTATGTAGTCTCACATAACGCAGCTCAATAAGTATACATAGCTGTGCCTGGTCGAGTTGAATAACAAG CCTCAGGTGAGTCTTAGCAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910284: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102841906748AA269281MU1MA091.ALSS. mansoni Schistosomule Lambda Zap


Date: 8:17:37 on Wed 22 Nov 117.