EST 910285 is a singleton


Sequence

>910285 (1 EST) Length=172 AGACTAGGGACAGACGCCGCGGCGCGTCACTACCACCTCGGAGGGGCCCTGTTCCTACACGAGTTGTACCTGAAAGCATC GATATCGAATAGTTAGATATCTCGTCTAGATCGATTATCGCTAGCGACGACGACTGCTCGCGCGGGTGGTGGAAGCCGCG TACACCTACGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910285: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102851906749AA269282MU1MA092.ALSS. mansoni Schistosomule Lambda Zap


Date: 16:20:35 on Mon 20 Nov 117.