EST 910286 is a singleton


Sequence

>910286 (1 EST) Length=188 CACCCACCACTCGAGTTCTCTGCTTAGATATTCCCAACTCTCAACCCCGTTCGTTCGCCAACCCCTGCTGCGGCGCGAGA CCGAGAAGCATATCCTACGACCGTTAGCAACTGTTTTAGCATCACCTACACAAGCACTAGAGTAGTACATCTCAGTCCCT TTTCTCTATAGCTTTCAACACGTCACGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910286: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102861906750AA269283MU1MA093.ALSS. mansoni Schistosomule Lambda Zap


Date: 11:40:40 on Wed 22 Nov 117.