EST 910287 is a singleton


Sequence

>910287 (1 EST) Length=230 CGCTCTCAGACTGTGTGGCGCGTGAGCGCTCGGATATCTACCTATTGCGTCGCATGTTCGCTAGGTAGCCATCTCCAGAG ATACGGCAAGTATCGGTGAGATGCTGTATGGCTCTCACATGCGCGACTCGTTGTGCACCGCGATGAGCGAGACGAGATCG TGTACAGCGGCTCTGGCTATATCATATCGTTGGACTAGGTGATCTCGAGCACATCGTATAGGACGAGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910287: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102871906751AA269284MU1MA094.ALSS. mansoni Schistosomule Lambda Zap


Date: 9:55:44 on Wed 22 Nov 117.