EST 910289 is a singleton


Sequence

>910289 (1 EST) Length=195 TGATGCAGAGCATGATCGAGTACATGAAGCTCTGAAGCTAGTACCGGCAAGCGGAATTCAAATAGAGAAGTCTGAACCGG TACGGACTTTACTCCGACACTGCTCTCCGTGCACTCGTCAACCTAATGCTCAGCTGTAATACCCCATCGATGCGCGTAAA GCGTGTATATCCGTGGACTATCCGTGCATGTAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910289: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102891906753AA269286MU1MA096.ALSS. mansoni Schistosomule Lambda Zap


Date: 1:11:23 on Tue 21 Nov 117.