EST 910290 is a singleton


Sequence

>910290 (1 EST) Length=222 TGATACGCGCTCGAGAGAAAGTCCTCGGAGAGGATGCCATCTGCGGTGTTTGATTCGCGATGCAGTCCAGACACTTCGTA GAGACTAATCACAACCATCGCCATGAATCACATTATAGTTGTGTGCCTCTTAAGCCTCTGATATCCAACGATGAGATACC GGAGGTACACCAGAAACATCTCGAATATGTGTATAGTAGACTGCATAAGCATCTAGTCTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910290: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9102901906754AA269287MU1MA097.ALSS. mansoni Schistosomule Lambda Zap


Date: 13:34:57 on Fri 24 Nov 117.