EST 910308 is a singleton


Sequence

>910308 (1 EST) Length=280 GGGTTGGAATACGGCCCGTAGTGACTCTAATCAAAAAATATCCGCGCAAAGTACCTTCGATTTTGTTGGCGGAAGGTATT TCACCCAAACTGACTGCAGACGATATGGTATACGAAGAGGTCAAGATGGAAACGAATGAATCTCCGTGTATAAATGTTTT ATTAGTAGATGACGTGCCTGGACTTGGTTCTGTTGGAACAGTAACTCCTGTACATCGTAATAAGTTTTGGAGATATTTGT ATATTAAAGGACTTGCTGAGCTACCCACAGAGAAGATCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910308: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103081907426AA269305MS1MM011.AS6S. mansoni sporocyst Lambda gt11


Date: 6:10:53 on Sun 19 Nov 117.