EST 910310 is a singleton


Sequence

>910310 (1 EST) Length=179 AGCGGGACCGTCGTTCATTTACCGAAAAAGCCTTTTGGCAATGCTCTTCAAATCCAAACGACGTGACAGATCTTATAGCA AAAGCTGAAAAATGCTTAAAAATATCCTTACCTAAAGAGGAGACCTGATTATGATGGTGCCAATCGAATACTATGGAAAG GCGATTACTTTATAGAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910310: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103101907428AA269307MS1MM019.AS6S. mansoni sporocyst Lambda gt11


Date: 21:53:50 on Sat 18 Nov 117.