EST 910311 is a singleton


Sequence

>910311 (1 EST) Length=114 TTGATAATCAAAGTGAGTCGAATTCTGTATTGAAAAAAGCATTACTCAATGTTCTGATGGTTTTCTTCTAAAAAATACCT AAACCGCATCTCAATCTTTCTAAAGTTAAAATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910311: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103111907429AA269308MS1MM022.AS6S. mansoni sporocyst Lambda gt11


Date: 11:37:43 on Fri 24 Nov 117.