EST 910314 is a singleton


Sequence

>910314 (1 EST) Length=282 GGAATTCGGTTTTTTTTTTTTTTTTAGTTTTAACTTAGGAAAAGTATAAATAGAGGAGACATGTTTGTTTTGTCAGTCCA TAACCGCTGCACTTGTTCTAAGTTAAAACTAAAAAAAAATTTTTTTAACTTCTAAAATACATTAAATTTATTTATTAATA CATACTTTCATCCACACCGAGCTCTGTGTATCTCAATGAGAGACTGACAGGCCGAAACAAATTTAAAGGCTTCACGGCAC CAAAAGAAAATATTTACCAGTTCAAAGTTCTCTCCTATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 910314: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103141907432AA269311MS1MM020.AS7S. mansoni sporocyst Lambda gt11


Date: 23:15:58 on Sun 19 Nov 117.