EST 910317 is a singleton


Sequence

>910317 (1 EST) Length=601 GGAAAAAAAAAAATTCAGAAAGGACGTCAGGGGATAGTTGCTAAATTAGCGCAGGAATAAAACAAAAGTGCTAATGACAA CAGAGGCATCAAAAATACTTATCGGAAGAAAAATAAAAATAATTCAGCAAGGACGTCAGGATATAGTTGCTAAATTAGTG CAGGAATTTAAAGAAAGTGCTAATGACTTATCAGTTGCTAAATTAGTGCAGGAATTTAAAGAAAGTGCTAATGACTTATC GAAAAAAAAAAACCAGTTCGAACATCGAATTAATAAACATGATGAAACTGTCTCTTTGTCATCAGGTGGCATCTAGTGAC ATCTGTAAAGGTTTCTTGGTTGCTGTCATTAGTCATTTCAGATATCGAAAAAGTTTGGCGTTGGGGGGCAGGGAGATAAA GGAGGAATGGGAATAGACTTGAGGTCGTCTTGGAGTCTGTACATCTGAACTGGAAGCAAACTAAATATGTCAATTGCGCC AGTGCATCTGAGCAGATGTAGATTAGGGTGTCCATTGAGTCAGTGTACAATTCTGGGCTGTCATGGTGTCTGCACATGTT GCTTCCGTTCAATATTCGTTCCTTAATAGCCTTCAGAAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910317: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103171907435AA269314MS1MM010.AS6S. mansoni sporocyst Lambda gt11


Date: 19:13:59 on Wed 22 Nov 117.