EST 910318 is a singleton


Sequence

>910318 (1 EST) Length=153 GAGGATCAAAGTGTCGAATACTTCAATGAGATGAAAATATTTATTTTTAACATATGTACGAATGTAATCGATTATTGTGT TTGTAAATCCGCAAGAATATGTTGTATATNAATAAGAAATATGTTTTTTATATCTACATTGGCCTCCAGTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910318: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103181907436AA269315MS1MM004.AS6S. mansoni sporocyst Lambda gt11


Date: 3:57:38 on Sat 18 Nov 117.