EST 910320 is a singleton


Sequence

>910320 (1 EST) Length=199 GGCTTGGGGGATCCTGGTAGCGACCGGCGCTCAGCAAAAGCGTCACTTAAAGCTTCTTCGCGGTCCNCGGTTCGGAATGA CAAAAACGGTCTTCGATTAAGGCGATTCCGAAGTAGCGATACATTTCTTCTACTTTGACAGTTTGGTCAAGACCAACATC GTCCAAGATCATTTCCGCATTCTCGTTTTCTACCAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910320: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103201907438AA269317MS1MM006.AS6S. mansoni sporocyst Lambda gt11


Date: 14:38:59 on Sun 19 Nov 117.