EST 910323 is a singleton


Sequence

>910323 (1 EST) Length=214 GTCACTTGACTCGTCACATCCATTAGTTATTGATATTTTGATGATATTGATTGTATTATTTGGCAAAGAAGTAGGGATTT TAGGATACTGTCTTGATTAATCGTGAGACGTTCATTCCAGAGATACGTTTTNCAGATGCATCTGTTAAAATTATGAGACT GNGAGACTACGATGTAGCGAAATGATTATTACCAGTTTAGAGCCATTCGAAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910323: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103231907441AA269320MS1MM016.AS6S. mansoni sporocyst Lambda gt11


Date: 17:6:18 on Wed 22 Nov 117.