EST 910326 is a singleton


Sequence

>910326 (1 EST) Length=540 GGAGAGATCTAGATTTGGTTTTATTTTTCTGGGTATAGTAAAGAAATAATCACAAATTTATCGATAGATAGAGAAGGACA ATGAAACTAATACACAATAAGTATTGGCTACGTTAGTGTGTTTAAGATTTTGTTAACAGACTTAAATAGGTCGCCATGGG GAGTCACTAAACCTGGTTTTACAACAATCGCCACTGTGGCAAAGGATTTCAGAATAACATCCTATGTCTAACGTAAATCT ATCCCCAACGTGGCTTCACCAGCCTTGTAAGTACTAGCAGTCAGACAGTAATTTTCTAATGTATTACTGAATGCGTNTGC ACTACACCTGTTAATCTACCATTCGTAGTAAAGTTACCTACCAATGAAGACGGCAAGCCATTGGGCAGCCTGTGTAGTTT AAACCTGCCTGTTCTAAGTAGGCTGAGGTCAAAAGATGCTGACCAAGTGGACTTCGCTGGTGCAAGGGATGTAGCAGTTG CCGGAGAAACGNACTAAACCCGGTTACCATAACAGACTANATCTACGGCCNCCCACTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910326: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103261907444AA269323MS1MM003.AS7S. mansoni sporocyst Lambda gt11


Date: 23:58:39 on Sat 18 Nov 117.