EST 910328 is a singleton


Sequence

>910328 (1 EST) Length=157 GTAGTGCTAGCCTGGGGTTATCTGAATAGCTAGGATCCGAATACGCGTTCAACCGTACAAGACATATCAGTGGNNTCTAT CAAGACATATCATTATGTTACTCAGAGGAAGTGATCATCTTATTGGCCTCGAGTCAGTGTCTTCGTGTGAAGAGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910328: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103281907446AA269325MS1MM025.AS7S. mansoni sporocyst Lambda gt11


Date: 16:33:46 on Sun 19 Nov 117.