EST 913951 is a singleton


Sequence

>913951 (1 EST) Length=491 GACAAAACGTACAAAGTTTGAAAATTGAAGTGAAGTGAATTGAAGCTTAATTCATATCATATTTCTCTGGTCTACTGCTT TTACTTATTATTCTAACTCTTTTGCTTTTCTTTAGAGCTTAACGTTTAGTTTGGTGCAGTTGTACTATTCGTCCAGTGGA AATTTTTTTTTTCAAAAACTACATATAGTTAAATGGCTAAAATTGAACGTAAAAACATTGATCTTACACCGCTGAAAAAA GCCAATGTNCCTATTTNCTTTATCGTTGGTGGTCCTGGATCTGGCAAAGGAACCCAGTGTGATAAAATTGTAGCAAAATA TGGCTTAACTCATCTTAGCTCGGGTNACTTGTTACGTGCTGAGGTGAAATCCGGATCGCCACGCGGATCGGAAACAAGTG GACGAATTAAATGATAATATTGATACGAATTAAAAAACAACTCCTACCTATATAACTGCAACGGCNCCANTTGTTCAATT ACTATGAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 913951: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9139511911875AA272948SW3ICA2381SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:59:45 on Sun 19 Nov 117.