EST 913967 is a singleton


Sequence

>913967 (1 EST) Length=513 ATTTTAGCATTTTCCTTTTTTCACACAAATTAATAATGTAAATAGCAAAATGAGTAATACATTCTCCCTATTATTTATAA ATAATAAGTTAGCTTTAATTGGAATATCTATTTCTATTTGATTTTTATTTGTGATAAATGATATGAAATGAATATTACAT TGAAATGATACATTTGATTAGGAAAACAATTTGCATTTCATTTATTCTATCTGAAATGAAAAATAAAAATCTTTATTTCA CTTATTTAAATTCTCAAATTTTATAATAGTAATATAATTAATTTATTTCTTTTTTCTTACAACTATCATTTAATTCATAC CATTTTATTTTGTTATATCCAAAATTTTAATATTTTTATCAATTGGCAACATTTGCTATTATTTTTCAGGCATTTTTTAT TTTTCGTCTTATTTTAAATAAACTGATAAGGGTCAGAAGTTATAAAACTATAGAAAATTACTGTCTACATTTATGCTGTG ATGTTTGTTGGTGATAAATGGGTTATGGGTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 913967: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9139671911891AA272964SW3ICA2459SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 13:17:22 on Thu 23 Nov 117.