EST 914074 is a singleton


Sequence

>914074 (1 EST) Length=611 AATTTTGCTTAGAAAAAAACCTGAAAAAAATGTGGGTTTATGCATGAATTCAAATTTTACTGGCAACAATTATCCGACAT ACGATGGAAATTTGCGTGCCGTCATGCAATGCAGTATATGTGCTGTGTTGCTATGCAGTGTGCGTTCATTAATTTGAGTT TAAAAAAATCCGCAAAATGTAGTTCTTGCGTTACACTGCGATGAGCTTGATCGGGAAGAAGACCAATAGTAATGACATAC CAACAACATACAGAGCCGACAGACACACTTCAATTTCATTAATTTCAAAAGCAAACTGCATGTGGAAATTAAAAGGCTTT AAGAAAATAGTGATGTGAGCGTACTTGGCTGATCTGTTGCTTAACTATTGTTAGCTAAATGATGTGTGCCCCTGGCAGAC ATTGTTTTGGCACTAGTTGCAGTTGATGTTTGGTCAACGGGCTGTATATTTGGCGAAATGATCCGTGGTAGTGTATTGTT TCCGGGCAATGATCATATTGACCAATGGACCAAATTGTTGAACAGCTTGGTACTCCTCCCTGATGTTCATGCGTCGCTTG CAGTCACTGTCCGAAATTATGTTGAAATCGTCCCATTTCCCTGGTTTTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 914074: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9140741911998AA273063SWMFCA1851SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:45:35 on Sun 19 Nov 117.