EST 914076 is a singleton


Sequence

>914076 (1 EST) Length=595 CATAAGTTCATTTTTTTACATAACTTATAACACAGTGTATTGCTTTTATTGGTTTTAATACTGTTTCGGATTTCATTTTT TTCTTTACTCAACTTTCTTGTTATGTTTTGTGCTGCATTGTAAGCTGTCAATTTTTTAAAATATGATTTATCTTAACAAC TATTTGTGAATGCATATCGTCTTGTACATCTGTTTGAAATAAGCCTAATTTTATGGTGAAAATCTGTATAATCGTATCAA ATTTGCCATTCTTTTATTGTACAAATTTGAACGTCGTGCACTTTGAACTCTAGCCATGTTCATAATTTGTCCCAGTGTTT TATCATACATGTAAACTTCTTTCCATGAAATTCATTCAGATAACTTACAAAACTTTAATTTTTTGCTCCTTCTTGCGTCG TTCCCTTCATAGGTTTATTCTGAGTTCTAAACTTTGGGATTTGAATTCATCGACCTCTATACTGTTACAAAATATGTTCC GTTTATTCTCATTTGTTCGATGCAGGATTTTTTAAATGTTTTTCAATTAACATTTTTTTTATCCAAATGAAAGGCAAATT TTGGCACATTTATATTTAAATAAATGTTAGTAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 914076: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9140761912000AA273065SWMFCA1855SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:10:12 on Sat 18 Nov 117.