EST 914083 is a singleton


Sequence

>914083 (1 EST) Length=631 TTACAACTGTGAAATCAGCTAAATCATCTCAGCCCTCTGGTATGGGATGGGACATCATTCTACCTCCCCGCCCCAAGAAA AAACCCACCTTTGCATTCCTTTGAGCTTTACTTACATTGCTTACGCTACTTACGTTTACTTGCATCTATGATAGTCTATT GGCCACGAGTCTTTCCTTGGTCTTAATACCACAGAAGAAATTGTTCACACCGCTGATTAAATATTAGTCAGTGCTTATTG TGTGCCGGGCACTGTACACTCAGTGAAGAGCAAGAGGCGCACAGGTTTTACCTTAGGAACTTAAAGCTCACCAGAGGAGA TTGTAAGCATAGGCTGTGCCCTTAGGTCCACAGCATACACTTAAGTTATTTGTTGCTGTATTGCCTGCCACTTCAACACG TAATAGTTCAAAAAAAACACTAGCTTCCCGTGCACAGTTCTGTGGGTTGACAAGGCTCAGTTAGCTGGTTATTGCGGATG GTCACCTGTATATCTGGAGTCCTGTGGTGGCTAAAAATTGAAAAAGTGGCTTTTTCATAAACATGTTGGAACCGGGCTGC ATTGGACAACATGTTTGAAGTTAGATAGGTACTAAAATCTAAATAGGCACTTGGCATCCCTTNGGCTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 914083: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9140831912007AA273072SWMFCA1882SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:46:44 on Sat 25 Nov 117.