EST 914085 is a singleton


Sequence

>914085 (1 EST) Length=627 GTTTGCTGATTAGATCTGGCATCAATGATTGTTCTCGAAAATTCCGATGACTACTTGAATCCTCTTGCTATTCTCCGCGA CGATCTACTACATGAAAAGGTACATATACATATGAATATTTTTCGTCATTTACCAACTATTGGGCATAGCAGTGCGGCNT ANAGCGTTCACGTGTCGACTTATCTCAGTTCTTAACANACACTATCGACGGAGAGGGATGAACTACTTCTCGCTTTGGCC GATCAGTTAGGCAACTTCACGCCATTAGTTGGTGGCCCAGACTATGTCTACTGTTTGCTTCCACCACTTGAAAATTTAGC TACTGTTGAGGAAACCGTAGTGCGTGATAAAGCTGTGGAAAGTTTACGCAAAATCGCAGATAAACATTCAAGTGCTGCTC TCGAAGAACACTTCATCCCAATGATCAGACGTTTAGCTACAGGTGATTGGTTCACATCGCGAACCTCGGCATGTGGACTT TTCAGTGTCCTTATCCCAGATTGAGTCCTGCTATAAAGTCGGAGCTTCCGAATTTATTTCGGAAATTATGTCTGATGACC CCCGATGGGCGACGTGCTGCAGCTTCCAAATTAGGCGAATTGGCAAATTTCCAAACCAATTTCCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 914085: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9140851912009AA273074SWMFCA1884SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 22:8:41 on Fri 17 Nov 117.