EST 914113 is a singleton


Sequence

>914113 (1 EST) Length=308 AACTATAGCTATAAGTGTCTTTCTTCAGTCATATATATTTCAAAAAAAAAAAAATTATATTTTCCTTNGGAACNCANTAA AATTTACCAATNGTTAATGAAATTATNGTTTTANTNGCTACTACTACAATNGCNGCAAATATCANTGCAACNCATNTNTC ATCAAATAATGACNTAAAAGGAAACGTTATNTTANTTAACAAAAACAGTGAACCAGGGACCGATAAAATCAGTCAATGTT GAAATTTGGTCACTTTNATGTCACTTGGTCCACTTTTAATTTAATTTGGATGTTATAAAATTTTTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 914113: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9141131912483AA273109SWMFCA1940SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:1:58 on Fri 24 Nov 117.