EST 914115 is a singleton


Sequence

>914115 (1 EST) Length=753 ATATGTCAGGGAACACAGAACTAAGTGAGGGTGGGATCGTTANGAGCGACAACCNNACTCCAGCTAANCCGGAGCAGCAA CGGGGCTTCGATACATGGACATTCATTAAAGGGATGCTGTATCGCATTATGATCGTTTACTTTGTAACGTCATTTTTGAA AAATTTTATGAGTGGACGGTCTGGTGGTGTTGGTTATAATAATACGGGAGTGTCGAATACAGGTGCATCTTTACCCTCGC GAAATCTTTTCCAACCAGGGCAGAAGTTTGATCTATATATATACCTCTCGGATTCGCAGGATAAATTCGATGAATTTGAT GACGAAAGTGCGCTGTTTTGGAAAGAAACCGGCATGACATATAGTGATTGGACATCTGGTCCAGATGGTGATGGTTCACG TACTAAATCAGCTACATTTCCCACTCCCAAATCGCTTGCTAATAATGGCTCGTTATACATACATGTATAATGTACGGCAA CTTAATAAATACAAGAAGAAGTATTATAAAAGGACACAAAATCTACTTACTGGTAAGACAGAACAGACTGAAGAAGAACA AAAGAAGGCTGAAGTGATGAGTTTTGAAGTACTCAATTATTGGCACCAAATTTAACGATAGTCTTGTCGATGATCAGACG CATGGCAAAAAGGTCTTTGCCATCCCCCCTTGATGAACCGTTAAGTTTGAATCTATTGACACACTACAAGCCCATATTCT TTTCACGAACTATGGAACTTACCGGCGATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 914115: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9141151912485AA273111SWMFCA1950SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:9:31 on Wed 22 Nov 117.