EST 914118 is a singleton


Sequence

>914118 (1 EST) Length=668 GGCAGATGGAGCAAATCTCTCAGTTCCTGCAGGCAGCTGAGCGCTACGGCATCAACACCACTGACATCTTCCAGACTGTG GATCTCTGGGAAGGAAAGAACATGGCTTGTGTGCAGCGGACACTAATGAACCTGGGTGGGCTGGCAGTAGCCAGGGACGA TGGGCTTTTCTCTGGGGATCCCAACTGGTTTCCTAAGAAATCCAAGGAGAACCCTCGGAACTTCTCGGACAACCAGTTGC AAGAGGGCAAGAATGTGATTGGGTTGCAGATGGGCACCAACCGTGGAGCATCTCAGGCTGGCATGACTGGCTACGGGATG CCTCGCCAGATCCTCTGATCACACACCCCTCTCCTGCCCCTGCCCTCCATGAATGGTTAATATATATGTATATATATGTT TTAGCAATGACATTCCCTGANAGCCCCTGGATCGCTAAGCTCCCCTCTGCCAGGGTGGGCTCCTATCTTGTCACCTCTGG CAGTGCTTGATGCTTGTCTCTCTCTCTCTCTCTCTCTCTGGGCTTACTAATACATTCCTTCCCACAAACATCAAAACTGG ACCAATTTCCCCCTGGGAACAAAGCTTCCTTTCCCCACATTTTTCTGCTTTTCTGAACTCTGTGATTCACCCATTCTTTG GCTAGAATCTAAGATCTGCCTGTGCCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 914118: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9141181912488AA273114SWMFCA1962SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:34:15 on Thu 23 Nov 117.