EST 914126 is a singleton


Sequence

>914126 (1 EST) Length=489 TCAATACATGCTGAAGTATAATTCCCACTTCTTCGTCTTTCTTCCAAACTTTGCTGTAATGCCACCGGTGTTAACCATTC TTTGGGTAAACAACGCTCCAAAAATGGTATCGAACTTGATACAGTAGCAAGTCGATTTACCCATGAGGGTATTTCTTTTC CGGTTAGCGTCTAAAATGAAATAATAGCTGCTATCATTGTAAAAGTCATAAATTATTTGGTAAGCTAAAATGTTATCATA TGTATGCTATAGAAATTGTTTTCATTCATTTAAAAATTGACTGGTTCATATTTATTTTATGCAAGTTTCAATTTTTTTTT GAATAATATTTCTTTCACTATTTGAAATGTTTCCTTTAACAATAGCTCCTATGCANANTATATGCTACATTAAAATATGA AATTAAACNTGANAACATTATATAATATTTCATTTTTNCCCAACNCATGAATAAGCCNCCAATGANACNCCTTCCAANTT AANTTNTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 914126: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9141261912496AA273122SW3ICA2099SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:42:16 on Tue 21 Nov 117.