EST 914169 is a singleton


Sequence

>914169 (1 EST) Length=476 CCAAGTTTGAGAATTTCCGAAAATGGCCGAAGCAAAGAATCGAGTATGTCTGGTAGTGATTGATGGTTGGGGAATCAGTA ACGAAACTAAAGGCAATGCAATACTAAATGCTAAAACACCTGTAATGGATGAGCTTTGTGTAATGAATTCGCATCCAATT CAAGCACATGGCTTGCATGTTGGTTTACCGGAAGGACTTATGGGCAATTCAGAAGTGGGTCATTTAAACATTGGCGCTGG CCGTGTTGTTTATCAGGATATTGTACGCATAAATTTGGCGGTCAAGAATAAGACTTTGGTGGAAAATAAGCATTTGAAGG AAGCTGCTGAACGTGCAATTAAAGGGAATGGCCGCATGCACTTATGTGGTTTGGTCAGCGATGGTGGTGTTCATTCACAT ATTGATCATTTGTTTGCTTTGATAACAGCTTTGAAACAACTTAAAGTACCGAAGCTTTACATTCAATTCTTTGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 914169: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9141691912539AA273165SW3ICA2592SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 20:58:34 on Sun 19 Nov 117.