EST 916412 is a singleton


Sequence

>916412 (1 EST) Length=411 GTGATGACGCTGACTTGCGTGCGTTGATTGACGTAACTCAACAACTGTTTCCTATTGAAATGCTTGCAAAAGTCGTCGTT AGTATTGTCGAAGCTTTATTTGTATCATATGGTTTTGGATCAGTACCTGCTGGACAAACACCGGGGAAAGTTGCGTTAAA TATTCAAGTGATTACTTGTTATCAAGTGATACCGATAGCAGGTAGCGAAGTACGTGAATATCGTTCGGACGCTTGGTGTT CCATTCAAAAATTCTTTGCTACGATCATTAACGAAGAATATGCTTATCAATCTACTTTTCCCGCTTAGTGCAGCAGCTTA TGCGTTTACCTACAATCGTGCTGGCTATGATATTGCTGCGAGAACGATCGTTGTTAACGCCTANAATCATTTTCTATTGT TTTCCATTACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 916412: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9164121917032AA275397MB4SLY1A08T3Brugia malayi L4 JHU93SL-BmL4


Date: 0:38:37 on Thu 23 Nov 117.