EST 916439 is a singleton


Sequence

>916439 (1 EST) Length=404 TTGCAAATGTTACCCGGTTCAAACAGTTTGCACCGTATATCTCAGCGTATTCTGCATAATGCAATACGAACAATGTATGA TAATCCGTATATAAAAACATTTAAGCCCAAAAAGCCTCCATCACCAAGTTTTCATAAACAGACAACGGGATTAACTGGCT TGTTTGTTGATGAGTATGCACATCAAAACTTGCTGAAAGAATATGGACGATTAATGAAAGTACTAGAACAAATGCCTTCA CATTCCTCATACCGGAAATATACTGAACAGCTTGTGAAGAAGAGGATAGCACTGGTGCAAGAGGAAACAGATATTGTCNA GCTGGAAGAAAAAATTGGTATGGGACAGATTGAAAAAGTTATCTTACAGGCAAAATATGAAATATTAGCAGCAAAGGAAA TGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 916439: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9164391917059AA275424MB4SLY1D04T3Brugia malayi L4 JHU93SL-BmL4


Date: 18:22:58 on Sat 18 Nov 117.