EST 916485 is a singleton


Sequence

>916485 (1 EST) Length=369 CTGCCACCAGCACGGTATCAATCGCTTTCAGGTATTGCTCACCGTGTAAATCTTCCAGCACCGTCAGGTTGATGCGCGAA CGAAGTTCCGCTACTTCCTCGCGCAGTCCATCAAGCCCTTTTTCCAGCAGCAGCGGGAAATTCACCGCCAGGTGCGCATC GCCGGAGGTCATATTGCCTTCCGCTTTAATGAATTCCGGTCGCCAGCAGTCCTTTTTGCTCATCGGTAAACATGCCGTAG CAGCGAACCTGTACGGTCTGAACGCGCCACCACGGGCACACTTCATGCAGAACGCGTTTGTTCTCTTCGCTCACCGCAAA GCCAGCACCGGGTAGAACTGCCAGAATCATCAATCTCTTTTTCGATCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 916485: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9164851917105AA275470MB4SLY1H04T3Brugia malayi L4 JHU93SL-BmL4


Date: 16:17:27 on Mon 20 Nov 117.