EST 916498 is a singleton


Sequence

>916498 (1 EST) Length=194 CAATCGATGCTACAAGCAACAATAGCAGTAATGGGGCGAAAAAAAAATGACAGTTATGCTTGCAACTACGACAATTACGC TTAGGGCGCAAATTAATGAACTGTTGCTATAGTTTAGTATTACTTCATTTATTTCTTTCCTATATTATTATTCTATAAGC ATGATGTTGTAAAAGAACAATAAAGTTATTGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 916498: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9164981917118AA275537MBL2SK1A08T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 0:39:41 on Fri 24 Nov 117.