EST 916516 is a singleton


Sequence

>916516 (1 EST) Length=375 CAGTGATCAGTAAATATGCATTTGGCACTGATTTTCATTAGTAGCGTCCTATTCGTCATCCATGTTCAATCGCAGACACC GGATGGATGCCAGATGGCTATCCAATCATTAATCACTACCCTTGCACAAGCAGCAGCCAAACTCGATGATGGCCAACACG TCGAATTACATGCCAGTGTGTCTAGGCTAGCCAGAACCATCCAGGATTACAGCAGTCAGAAAAGAACGCAAGTGACAGGT AATCGCGATAACTGCATTAAAGCGATGAAATCTGTACATGCAAGTATTGCATCCATCGCGCAGAAATTGCATGCAACCAA AGGTAGTGATGCGAAACTTATTGCTGCTGCTAATATTATTGATGCAGCTGCCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 916516: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9165161917136AA275488MBL2SK1C10T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 7:20:5 on Mon 20 Nov 117.