EST 921449 is a singleton


Sequence

>921449 (1 EST) Length=454 AATATCAGAAGCAAACATGACTGATGCANCAGAACATGAATGGGAATTAAGTCGTGAAAATATCCGACCGCTTAGAAGTG GCCGAAAGGTGAAATCTCTAAATAATGTTTTTGGTGGTGTCAAAATTACAATTGTGGAAGCAGAGGAACGTTTCGAGAAT GACTTCGAACGAGCAAAAGCATCAGATGATCCATTAGATATATGCTTGCATTATATAACTTGGTTCGAAGAGCATTTCCC AACAGGGAAGCAGTCACATCTTTTTTCGATACTAACACGCATAATTAACACTTTTGGTTACCGTGAAGAGTTTTTAAACG ATGAAAGGATGTTAAAATTTTGGATAAAATTAATCGAGAACAAATCTGATGCTAATGTGGATGCATTTTTTGAACGTGCT TATCTTGCAGGGTGTTGTCGTCGTTTGGCTAAATTTTATGTNAGATGGGCTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 921449: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214491923300AA280439SW3ICA2495SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 5:58:18 on Wed 22 Nov 117.