EST 921453 is a singleton


Sequence

>921453 (1 EST) Length=99 GTGATATTTAACACATTTCTCAATAAAAATTTGAATCTTTAACATGAATTATAAATTTTGAAAGTAATTATTTCTTCTTT TTTTTTTTCCCTTTTNACN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 921453: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214531923304AA280443SW3ICA2603SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 8:20:41 on Thu 23 Nov 117.