EST 921457 is a singleton


Sequence

>921457 (1 EST) Length=438 CGAACATTTTTACGTGGAATACAANANAAAATGACGCTGAATAAATTATCGATCGATAAANTGGATGTGAAAGATAAAAG GGTCCTGATTCGGGTCGATTTTAATGTACCATTGAAAGATGGCAAAATTACGAACAACCAACGTATTACNGCTGCTCTGC CACCGATTANACATGCACTCGATCATGGCGCAAAAGCNGTCATATTAATGTCACATTTGGGACGTCCAGATGGGATGAGA AAGATGGANTTCACATTGGAACCGGTTGCAGCAGAACTAAAAGCTGTTCTGGGCANNAATGTCACATTCGTGCATGATTG TGTTGGGCCAGGAAGCCGAAAAAGCTACAGCTGATCCTGCTCCCGGCAGTGTTATTTTGCTTGAAAATCTTCGATTTTAT TTGGAAGAANAAGGANAAGGTGTTAATGAAAAGGGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 921457: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214571923308AA280447SW3ICA2607SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 13:25:17 on Wed 22 Nov 117.