EST 921467 is a singleton


Sequence

>921467 (1 EST) Length=619 AGAAGGAAAAGGTCAAGAGCCCTATTTTATTATGAAGCTGGGCTCCAACGTTAGACCTCTCCCTGGAGAAGCCTCAGGGA GCCCTGCCCAGTGCATCACTGTCTAGCATGAGGTACTTCTTGCCACACAGCCTCAGAGAGATCATGTGACCTGGCTCCAG TTGTCTTATCTGCCTGCTGGGGTTGTGGTTCCTGCTGAGCCTGTCTTACTGGGCCGTTTCCAGACTCCGCTCAAGCCTGT GAGGCCTCTCTCCCTAAACCAAAGCTGTGTAGTTATAAACGGCAATGCCAAGGGAGCCTTTGAAGTATGTGTCATCTCTG ATATGTAGGGACAGTTATTTTTTAAAAGGCTGACATCCTGTCTAAAGCCACTGGTTTGCGGGGACACCTGCGCCGAAACC ATTCATTATTCTCAAGTTTACAAGCAAAGTGGTGGAAGTCTGGGTTAAACCGATTGGGCCAGAAAAGCAAGGAATTTGTC TCCCACTTGTTATAAATAACCGATTGCCCTGGTTTCCTGAAGGCACACTGGGCTCTGGGATGAACTCGGCNNAAAATTCC TTATCCTGAATGTTGGGGGCTTAGTGTTTTTGAACTCCACTTGACCTCTTTCCAAAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 921467: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214671923318AA280457SWMFCA1989SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:43:34 on Mon 20 Nov 117.