EST 921471 is a singleton


Sequence

>921471 (1 EST) Length=761 GAAAATCGGGCATTGGAGTTGTTACAGGAAAGGACACAAAGTCGTCGAAATAACGAACAAAATCGGCCAAAGCGAGTGCA GCTAGAGAGTTCATCATCTGACGAAAAAGATTCGTCAAACAGTGAAGAAGAATCTGGTAGTTCGTCGGGTCCTTCAGTAG ATGTTTCCAAAGTTCGCAACAAGAAGAAGAAAACGGAATCGAAGGGTAAATCGGCGAGAAAAGCTAAATCGGTTCTGCAA AAGAAGTTACTCGTTGATGATGAAGTCGAGTGTAATGATGATGACGATGATGGGGTTGACAAGGATTCGGAAAGGTCTGA ATCAGAGGAAGAACATTCGAAACGAAGACGCAGTCGAAAAATAGCAACATCAAAATCTTGTAAAAAGCAGAAAAAAACCA CGTCGTTGTCATTGGATGACGTATTTGGAACTTATTCCACGGATGACGAATCTACAAAACATTCCAGAAGTTCCATCGTC CCATCACTATACAAGGGAAAAGGATGAAAAAGAAGAAGGTGGAAAAGCTGTCCCCAAGATCGATGGAAATCCGAAATTGG GAGACGAAAAAGAGAAGGGGGGAAATACTAAGGCGTTTAAGTTTAAAGAAAGAACGCCCAAAGGGAAAATTGGAGGAAAG TGATGATGAATCTTGTGAAGAAGGAAAAAGACGTCCCCGAAAATTGAGAGCAGCCAGTTTGGGAAAATCGGTGAAAGAAG GTTCTGGTTGAAACGATGCCCCAAAATAAGAAATGTGTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 921471: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214711923322AA280461SWMFCA1999SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:4:38 on Wed 22 Nov 117.