EST 921474 is a singleton


Sequence

>921474 (1 EST) Length=665 AAGATTGGTGCTGTTGACAGTGAACGGTCAACCTGTATTCATGAACTCTGTGAAAGTTCTGAAATTACTTGCTGTGTATG TGGTGATTCACGAACAATTTTCACCGGTTCGAGTACAGGTAAAGTTTCTGTCTGGGATCTGACCGAACGACATCCTCGCA TTCGCTTTCGTCGCACATTAACAGCACATACAGAGGCAATCACTGCACTTGCTGTTTGTTCAGCACAAACCTTGCTTGTG AGTGGTAGCCGCGATGGCACTGCTATTGTATGGCATTTAAGTGCATTAACATTCATTCGGCAGTTGCGACCACACCCATC TGCAGTGACTGCTATTGCTATCAATGATGCAACGGGGGACATAGCTACTGCATCAGGATCCACGCTGTTCCTGTGGTCAA TCAATGGACGAACTCTTTCTGTAGTTTGATAGTGTTGACAAAGCTTCGTTTTGATCAATTTCCTAATGTCATTTTATCAC TGGCGTTTTCCTACGCTGGTATGAATGGGATCCAGAAAATGTGGTTATGTGTGGTGGTAGTGATGGTACTGTGCGAAATA TACTGTATGGAATTGTGAAGAAAATGAAGATGACTTAAATCCCAGAAAAAAGCGAATACCCACCAACTTGGCCAAATGAA TTTAAACAGCCGCCGTTGCTCTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 921474: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214741923325AA280464SWMFCA2007SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:7:2 on Sun 19 Nov 117.