EST 921476 is a singleton


Sequence

>921476 (1 EST) Length=720 GTTATATCATGGTATGCCGTTTGTGGATCGTAGAGGAGGATTTATCAAAAACATGTGTTTAACTGAATTGTCTGCTAAAA GAAGAGAGAGGAAGAAAGCGATTATCTGCAAGGCTTGGAATTGTCATATATCTATGCAGAACAATATCCAAGAGGAAATT GCATCTTCTGCTTATAACTTTGAAGATGTGTTTTATATGCAACATTTATATATTCCCTAACTCCAGCTCCGGGTTGGTAT AATGTCTTCAATCATTTTCTCAATTTTATGAAATTTTTATTGTATTTCTGATGACCAACTTGGATTCATTAACATTAGTA GCTTATCAAATTTCGTACTTTTCGCTGCAGCTGTTGCTGGTTATATTGCTGCTTATATTTGGGACCGTTGTCGCCTTCCC TGTTTTGTTGGCTAGATAGACAAGTGGTTGAAGTGTGGAAATTAGCGTCAGAACACACGGATAAACCAAACTACGAAAAG GCAAATATGCAACTTGATGGACAAAAGTGATGGCAGATTTGATGTTTCTACGGAATTTGTTTCTGTGATGAAATAAATTT GTGTGTTGCAGGTTGTTCCATATGTTTTTGACTATTTGATTTCCTTAGGAACACTTGCTCGTGAGTTACAAACTGTGTTT TGGTGGGTTCTACCTGTGAAATTTAACTGGAATTAGTACATTTAATTACTTCTCCGTAATTCTATAAAATTTGACTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 921476: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214761923327AA280466SWMFCA2011SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:18:48 on Fri 17 Nov 117.