EST 921480 is a singleton


Sequence

>921480 (1 EST) Length=354 CTCGTCTACACCAAGAAATCAGCCACAGACGCAACAAGCATGCAGGAGATCTCCAACAGCATCTTCAAGCAATGTTCATA TTACTCCGCCCAGAAGACAACATAAGGCTGGCTGTAAGACTGGATGAAAATCTGAACAGGACTCTAGACCCCAGCCAGGT TTCTTTGCATCCCCAAGAACTACCTCTGCCTCACTCTTCCTCTGAATATGAAAGGGCCGTTGAACCAACCCCCATGCTAA GAAACCCTGAAAACCAAGGGAACAGCCCATCCCCCCCTGTTGAAACAACAAAACCTTTGGTCCGTTGCAGTAACCACCAA ACATCTATCAACTTGGATTCCTTGCATCCCCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 921480: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214801923331AA280470SWMFCA2019SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:8:31 on Tue 21 Nov 117.