EST 921503 is a singleton


Sequence

>921503 (1 EST) Length=204 ATGAAATAAAATAATGTGAGAAACAATTAATACAAAACTACTTTTTGATATAAAAAAATTTTGTTCATATTTAGAATTCA ACAAATGCTTATTGATATTCTATGTCAGACTTTTTGACTGAAAAAATTCGTTTTCTCATTATTGATAAAATGTTCGCAAT GTGCCATATATGCATTTTTTTTTAGTGTGAAAATTATTGGATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 921503: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9215031923354AA280493SWMFCA2184SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 22:0:29 on Fri 17 Nov 117.