EST 921504 is a singleton


Sequence

>921504 (1 EST) Length=639 CTCGAAGAAGAATGATATCAAAAATACTTTTTCACTTCAACGTGTCAAAATCGGAAAGCTATGCTATCTGCGCCAACTAT GTATCATTTTTCGCATTGATATGTTTAACGCAATGCAGACTTTTAGGATGCGATAGCTATTAAATTGATCAATTCTCCAC GCAATTCTTCATCGAGAAGAAAATAATAGTCCTCTAATGTATTATGTTTGATTATGCCTTTCTCGAGCTGTGAAAATGAA ACATTTATTTATTTGCATTTTATTTGCTCTCTTTCTTTGATAACAAAATTTTTTAGCGTATTGTTTTCATATTTCAAAAT TTTTATGTTTAATTATGTCAAAAAGCTATCCTCTCTATCACTCAAATATTTTCATGTTTTATAAGTTCGATTGTTGAAAA AGCTTGAAGCAGTCATAATTTTAATTCTCGACTTACTTCCTGAATGATTTGTTGTTGCGGTGCACAGTTCGAATGTCGCT GCTTCAGAAAAGGCAATACTCCATCAGCTAAACATATAGCTCCGTGATCACATTAACCTGGAAATATCCTACTGAACTGA TAAGTACTCTGGCTAGAACCTTGGCGAAACCAACCCTAAGAAAAGTCCAATGTGTCCCATTGTTAACCGTGGTGAAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 921504: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9215041923355AA280494SWMFCA2185SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:43:1 on Wed 22 Nov 117.