EST 921513 is a singleton


Sequence

>921513 (1 EST) Length=640 TTGAGTGTTAGGGACGAAAGGGCGCGAGATATTTGGACATTGCAATGGACGTCAACGAGCTGCAAGAGGAAAACGATGTA TGCGAACGAAAATGAAATCGCGTGCCCCGGCAAACTATGATAGTTCCGGGTCCAGGAGCAGTAGTTAATGATATCCGTAA GATGTCGCTAACCAAAAGCAAAACGACGCTCCACAGCTTTGATCATCTTGTCAAAGATTTCAGTCATGCTACGAAATAAT TGTATGCTGCAGCAGTAGATTGTTCAATTATGTAACCAGTAGCAAAAATAACAACAGTGAGAATTTCAGAAACAGAATAC AGTTGTTAAGGGCTCGACTGTTTGTTTTATAGCCATTGTCGCGAGAATGCAGCTGCATAATTGTTACCAGCATTTGCATC ATCGTTGTACTGTCACTACTACGCATTTTTGATGGGAGATGTTTCACCTTTTACTCATGGATTTGAACATATAAACATCC ACAAAATGAATGCCCAAGATTGGGCGTTATTAGGAAATCTTATTTGAAATAAAGGGCTCTTCCCGGTGACTAAACATTAG TACCTAAAGGATCACTTTGCACAATCGTAGCATGCTCCCCTGGCTAATTGGTATGCCACAAAAATGCGACTTCCTGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 921513: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9215131923364AA280503SWMFCA2202SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:26:28 on Fri 17 Nov 117.