EST 924567 is a singleton


Sequence

>924567 (1 EST) Length=668 TNTAACGGAACTAGATGGTACATCANGGGGANACGATGCTCAATAATTGGATGACAAAATTTGATATAATTATACGCGGG GAATGACGATATAGTCCAATCAAGACAAACAAGGAAATCGCCTGCGCGGAATGAATCAATCCAATGCAGGTTTGACACTT CTCAAGGATCAATTATNTGATATTTTTCAACAGATCCTTTCTGTTAAGAANTTCGAACATCAGATAATCTTTAATGCCTT GCAGCTGGATANTCCAGATGAACAAGCAGCGGCAATTCGACCGAAGTTGCTACAAGAGANGAACACTGCGAGATATGTCT AAAATGAAGAAATTGATGCCTAATTTGTTGGTAAAAGATATGGAACTCCTTTTTATTGATGAAACACTTCAATCCCTCNA TCTACTTATCAGTAATTTGGAATCATACCTGTTACTCCCCAAGGCCCGANCGTTTTTTCCAGGGAAAAGGATCCCNAGGA AAANCNTGTTTCTTCCAAAGCTAAAATCNCCCCATCNAAATCTCTCCCTTTCCCNGCTTAACACTTNCATTCATTCCTTG ACAACTGATATGATACANTTTCTTGACTAAATGATCTCNCCTTCNTNTGAGTTTCTTNTGAATTCAATTAATCTCCTCCA TACTGTTTTGTCAAGATTATGNTTCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 924567: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9245671926169AA283475SW3ICA2114SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 12:29:44 on Sun 19 Nov 117.