EST 924571 is a singleton


Sequence

>924571 (1 EST) Length=641 GNNTTCCCNGGGCTGCAGGTAATTCGCCGACTTTTTCGCTACTCTTGCATTATCTGCTTGTTCATCTCATCACTTGGTTC CGACCACTCCAAACTTTTGATGGCATTGGATGGGTTTTACTTCTCAAATGAAGAGCAATAACAATATATCACTCAGCAAT TTTACATACTTCACCTTATCAAGAAAAAATTTATTTTCTTTAGANATCGGGCCTGTTAGAATGCCACATGTCAGTCTGCA GAGGAATTCAGGAAACCATATTGCGGAAGATGGCTCTTGCTGCAGGAAAAGCTGTAACACGTGTAATGCACAGATGTGAA GCAGCGAAAGCGTCCGGCTACCTTGGTGAGCACNACAAGGACAAGGGATAAGGGACACTCCTTAAAACAATCTTTTTTCC TTAAATAGAGCTGATATGAATTTCTAGGATCAGATCTCTCANATTGTGGCGTAATGTTTATCGCTGANGCAATATACCTT GTGCTGAAAGGGTTTGAAATTAATAAATGCCACCTGANAAATACCTCTCCCCAANTTCCTAAGAAAATGGTTGAACAATC CNCCNTATGANATTTCCATGTTGNAGGTAATGCANCNAGAATTCCNANTGAATTGGTGAATGGACTCATGCNGGGAATAA T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 924571: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9245711926173AA283479SW3ICA2118SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 8:43:26 on Mon 20 Nov 117.