EST 924591 is a singleton


Sequence

>924591 (1 EST) Length=481 GTCGAATGAAACATCAATATAAAAGAGAGCAAAAAAAAATTTTTTTGCATAATTTTCTCACTTCAAAACTTTATCTCAGT CAATTTTATGGATCATTTTTTGAACTAAATAAAAGAACAATCATTGAAGCATATAATATCACACTTTAAAATCTCAATTT TTATTTTATTCATTTTAATTGCTAAAACTACGTCTACTTTCCATCAAATTATTGCTGATTTTTGTTTAACTCATTACTTT TCCTCTCTCTTCCTTCGTCTTCATTATCAATTTTCCCTCGCCTTTTCATTCANATGTCTCAATTTTCATACAATGAAAAT TTCAAATGTTTTCTGTTTCCTTCATTTCTACCCACAAATAAGAATAACCCGTAGGTGAAATGTTTTTTTTTCCATTTGTC ATATGCGATACAATAGTATTACTCATTAACCACATCAATCAATTTTATTCTTTTCTCGTTAACTAATTTGTAAAGTTGTC A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 924591: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9245911926193AA283499SW3ICA2621SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:1:1 on Sun 19 Nov 117.